Overview

Clinical Phenotype: Blood Lipids/Lipoproteins, Hyperlipoproteinemia Type IV
Reference Assembly: GRCh37/hg19
Position: Chr19:45412033 ->GTGCGCCTCGCCTCCCACCTGCGC
Transcript: NM_000041; ENSG00000130203
dbSNP ID: NA
Coding/Non-Coding: Coding
DNA Change: Duplication
Expected RNA Consequence: Duplication
Expected Protein Consequence: Duplication
Codon Change: - to GTG CGC CTC GCC TCC CAC CTG CGC
Reference Isoform: APOE Isoform 1
Genomic Region: Exon 4

Findings

This variant, resulting in the predicted duplication of amino acids 153-160, was identified in a middle-aged Japanese man with elevated levels of triglycerides, apolipoprotein CII, and apo CIII in plasma typical of type IV hyperlipidemia (Yamanouochi et al., 2001). Total cholesterol levels were normal, but those of very low-density lipoprotein (VLDL) cholesterol were elevated. In addition, although plasma ApoE levels were within the normal range, the amount of mutant protein appeared to be lower than that of the wildtype isoform. The proband carried a single copy of the mutation on an APOE3/APOE3 background. Data from family members were unavailable.

The variant was absent from 806 Japanese males and from the gnomAD variant database (gnomAD v2.1.1, July 2021).

Biological effect

This variant is a tandem 24 base-pair insertion possibly caused by slipped mispairing and resulting in the insertion of a stretch of eight amino acids that duplicate the 153-160 ApoE sequence. This stretch of amino acids includes large portions of ApoE’s receptor-binding region, as well as of its main heparin-binding region. The authors speculated that either the mutation reduces the conversion of VLDL to low-density lipoprotein (LDL), hence the accumulation of the latter, and/or it disrupts binding to VLDL receptors (Yamanouochi et al., 2001). At the molecular level, the insertion is expected to lengthen helix 4 in ApoE’s amino-terminal four-helix bundle.

Nomenclature Notes

The variant was named ApoE5ss because of its migration on two-dimensional gel electrophoresis. Compared with the common isoform ApoE3, it migrates faster along the isoelectric focusing dimension because of its two additional charged arginines, hence the name ApoE5, but migrates more slowly along the SDS-PAGE dimension because of its larger size, hence the “ss” suffix. Another isoform, E189K, with a similar, but faster, migration pattern had been named ApoE5s by the same group (Yamanouchi et al., 1994).

Comments

No Available Comments

Make a Comment

To make a comment you must login or register.

References

Paper Citations

1. Yamanouchi Y, Takano T, Hamaguchi H, Tokunaga K. A novel apolipoprotein E5 variant with a 24-bp insertion causing hyperlipidemia. J Hum Genet. 2001;46(11):633-9. PubMed.
2. Yamanouchi Y, Arinami T, Tsuchiya S, Miyazaki R, Takaki H, Takano T, Hamaguchi H. Apolipoprotein E5 and E7 in apparently healthy Japanese males: frequencies and relation to plasma lipid levels. Jpn J Hum Genet. 1994 Sep;39(3):315-24. PubMed.

Further Reading

No Available Further Reading