Overview

Clinical Phenotype: Hyperlipoproteinemia Type III
Reference Assembly: GRCh37/hg19
Position: Chr19:45411989 ->GAGGTGCAGGCCATGCTCGGC
Transcript: NM_000041; ENSG00000130203
dbSNP ID: NA
Coding/Non-Coding: Coding
DNA Change: Duplication
Expected RNA Consequence: Duplication
Expected Protein Consequence: Duplication
Codon Change: - to GAG GTG CAG GCC ATG CTC GGC
Reference Isoform: APOE Isoform 1
Genomic Region: Exon 4

Findings

This mutation, a tandem duplication of 21 nucleotides coding for seven amino acids, has been identified in several Dutch families. It is associated with hyperlipoproteinemia type III (HLPP3), also known as familial dysbetalipoproteinemia, which is characterized by elevated cholesterol and triglyceride levels in blood, and early onset atherosclerosis and heart disease. The mutation is dominantly inherited with a high rate of penetrance (Havekes et al., 1986; de Knijff et al., 1991).

The variant was first studied in a 41-year-old man suffering from HLPP3 with xanthomas, fat deposits under the skin (Havekes et al., 1984). The man was diagnosed with HLPP3 in a clinic in Leiden, The Netherlands, and was initially thought to carry two copies of the APOE3 wild-type allele as suggested by the migration of his ApoE protein upon isoelectric focusing. However, the ApoE3-like protein, denoted ApoE3-Leiden, competed much less efficiently with low-density lipoprotein (LDL) for binding to the surface of fibroblasts than expected, suggesting a modification. Indeed, a subsequent study showed it was distinct from ApoE3 as assessed by isoelectric focusing after cysteamine treatment, amino acid analysis of cysteine residues, and SDS-PAGE (Havekes et al., 1986). This study also identified the modified protein in six of eight family members of the proband, spanning two generations. All six carriers had HLPP3, while the two noncarriers were disease-free. Wild-type ApoE3 was found in the serum of all affected members, indicating they were heterozygotes, and suggesting dominant inheritance.

Protein sequencing of ApoE isolated from the proband revealed the mutant protein included the C130R (APOE4) substitution, as well as an insertion of seven amino acids, GEVQAMLG, corresponding to the sequence preceding the site of insertion (amino acids 139 to 145 or 138 to 144) (Wardell et al., 1989). This finding explains the ApoE3-like migration of the mutant species: the negatively charged glutamyl residues within the insertion compensated for the arginine substitution at residue 130. DNA sequencing was consistent with the protein findings (van den Maagdenberg et al., 1989).

Dominant inheritance of this mutation was confirmed in a subsequent study of five additional Dutch families with HLPP3 (de Knijff et al., 1991). Analysis of 128 family members of five apparently unrelated probands revealed 42 heterozygote carriers. Although alterations in blood lipid profiles varied between these individuals, they all had elevated levels of cholesterol associated with very-low-density lipoprotein (VLDL) and intermediate density lipoprotein (IDL), an increased ratio of VLDL-cholesterol and IDL-cholesterol to total plasma triglycerides, and elevated plasma levels of ApoE. Multiple linear regression analysis revealed that most of the variability in expression of HLPP3 in mutation carriers could be explained by age, while body mass index showed a more moderate influence. Gender appeared to have no effect on either expression, or age of onset of disease. Interestingly, the presence of the common allele R176C (APOE2) in four individuals appeared to enhance the expression of HLPP3, while the presence of C130R (APOE4) in three individuals moderated it. 

Although at first the five families were thought to be unrelated, genealogical analysis indicated they shared common ancestry dating back to the 17th century (de Knijff et al., 1991). The variant was absent from the gnomAD variant database (v2.1.1, Oct 2022).

Biological effect

This mutant is defective in cell surface binding. Early in vitro experiments indicated its ability to compete with labeled LDL for binding to the surface of cultured fibroblasts was 25 percent that of ApoE3 (Havekes et al., 1984; Wardell et al., 1989). Moreover, subsequent studies revealed the impairment was likely even worse (Dong et al., 1998). The mutant protein was found to accumulate in patient lipoprotein particles, especially in VLDL and IDL, to a much greater extent than wild-type ApoE3 (Havekes et al., 1986; de Knijff et al., 1991). 

Consistent with these findings, in vitro incubation experiments showed that the mutant protein had a greater preference for VLDL of normolipidemic human plasma when compared to either ApoE3 or ApoE4 and, as a result, formed larger lipoprotein particles with more ApoE molecules (Fazio et al., 1993; Dong et al., 1998). To make normalized comparisons of the ApoE species’ receptor binding activities, researchers generated synthetic VLDL-like particles containing similar amounts of either ApoE3 or the mutant protein. These experiments revealed that G145InsGEVQAMLG has only about 12 percent of the LDL receptor binding activity of wild-type ApoE3 (Dong et al., 1998).

ApoE binding to heparin sulfate proteoglycans (HSPG) is also greatly impaired by this mutation (Ji et al., 1994a; Ji et al., 1994b). Experiments with cells and with isolated HSPG showed near abrogation of HSPG binding, as well as of HSPG-mediated cellular uptake of remnant lipoprotein particles. Moreover, G145InsGEVQAMLG appears to have a reduced ability to bind to lipoprotein lipase (LPL) complexed with HSPG, which may affect VLDL lipolysis (de Man et al., 1998). In competition experiments in vitro, the efficiency of mutant VLDL binding to HSPG-LPL was 35 percent of controls, and lipolysis was 77 percent. Also of note, the glycosylation of the mutant protein itself appears to be disrupted. G145InsGEVQAMLG found in plasma, as well as that secreted in vitro, is less glycosylated than wild-type ApoE3 (Fazio et al., 1993).

The insertion that characterizes this mutation is located at the end of helix 3 and extends into the loop that connects helices 3 and 4 in the four-helix bundle of the ApoE amino-terminal domain. Thus, it may result in extension of both helix 3 and the loop that could, in turn, alter the structure of helix 4, which contains the receptor-binding region (Dong et al., 1998).

Research models

Transgenic mice have been generated that carry a construct derived from a patient carrier, including the complete mutant APOE gene, the APOC1 gene, and neighboring regulatory elements (van den Maagdenberg et al., 1993). The mice have been used as models because of their human-like lipoprotein profile and their development of aortic atherosclerotic lesions when fed a high-cholesterol diet (see van der Vaart et al., 2024 for review). They have also been cross-bred with transgenic mice that express human cholesteryl ester transfer protein (CETP), an important component of human lipid metabolism absent from wildtype mice (Westerterp et al., 2006). This latter model mimics human responses to many lipid-lowering and atheroprotective medications.

Comments

No Available Comments

Make a Comment

To make a comment you must login or register.

References

Mutations Citations

1. APOE C130R (ApoE4)
2. APOE R176C (ApoE2)

Paper Citations

1. Havekes L, de Wit E, Leuven JG, Klasen E, Utermann G, Weber W, Beisiegel U. Apolipoprotein E3-Leiden. A new variant of human apolipoprotein E associated with familial type III hyperlipoproteinemia. Hum Genet. 1986 Jun;73(2):157-63. PubMed.
2. de Knijff P, van den Maagdenberg AM, Stalenhoef AF, Leuven JA, Demacker PN, Kuyt LP, Frants RR, Havekes LM. Familial dysbetalipoproteinemia associated with apolipoprotein E3-Leiden in an extended multigeneration pedigree. J Clin Invest. 1991 Aug;88(2):643-55. PubMed.
3. Havekes LM, Gevers Leuven JA, van Corven E, de Wit E, Emeis JJ. Functionally inactive apolipoprotein E3 in a type III hyperlipoproteinaemic patient. Eur J Clin Invest. 1984 Feb;14(1):7-11. PubMed.
4. Wardell MR, Weisgraber KH, Havekes LM, Rall SC Jr. Apolipoprotein E3-Leiden contains a seven-amino acid insertion that is a tandem repeat of residues 121-127. J Biol Chem. 1989 Dec 15;264(35):21205-10. PubMed.
5. van den Maagdenberg AM, de Knijff P, Stalenhoef AF, Gevers Leuven JA, Havekes LM, Frants RR. Apolipoprotein E*3-Leiden allele results from a partial gene duplication in exon 4. Biochem Biophys Res Commun. 1989 Dec 15;165(2):851-7. PubMed.
6. Dong LM, Innerarity TL, Arnold KS, Newhouse YM, Weisgraber KH. The carboxyl terminus in apolipoprotein E2 and the seven amino acid repeat in apolipoprotein E-Leiden: role in receptor-binding activity. J Lipid Res. 1998 Jun;39(6):1173-80. PubMed.
7. Fazio S, Horie Y, Weisgraber KH, Havekes LM, Rall SC Jr. Preferential association of apolipoprotein E Leiden with very low density lipoproteins of human plasma. J Lipid Res. 1993 Mar;34(3):447-53. PubMed.
8. Ji ZS, Fazio S, Mahley RW. Variable heparan sulfate proteoglycan binding of apolipoprotein E variants may modulate the expression of type III hyperlipoproteinemia. J Biol Chem. 1994 May 6;269(18):13421-8. PubMed.
9. Ji ZS, Fazio S, Lee YL, Mahley RW. Secretion-capture role for apolipoprotein E in remnant lipoprotein metabolism involving cell surface heparan sulfate proteoglycans. J Biol Chem. 1994 Jan 28;269(4):2764-72. PubMed.
10. de Man FH, de Beer F, van de Laarse A, Smelt AH, Leuven JA, Havekes LM. Effect of apolipoprotein E variants on lipolysis of very low density lipoproteins by heparan sulphate proteoglycan-bound lipoprotein lipase. Atherosclerosis. 1998 Feb;136(2):255-62. PubMed.
11. van den Maagdenberg AM, Hofker MH, Krimpenfort PJ, de Bruijn I, van Vlijmen B, van der Boom H, Havekes LM, Frants RR. Transgenic mice carrying the apolipoprotein E3-Leiden gene exhibit hyperlipoproteinemia. J Biol Chem. 1993 May 15;268(14):10540-5. PubMed.
12. van der Vaart JI, van Eenige R, Rensen PC, Kooijman S. Atherosclerosis: an overview of mouse models and a detailed methodology to quantify lesions in the aortic root. Vasc Biol. 2024 Mar 1; PubMed.
13. Westerterp M, van der Hoogt CC, de Haan W, Offerman EH, Dallinga-Thie GM, Jukema JW, Havekes LM, Rensen PC. Cholesteryl ester transfer protein decreases high-density lipoprotein and severely aggravates atherosclerosis in APOE*3-Leiden mice. Arterioscler Thromb Vasc Biol. 2006 Nov;26(11):2552-9. Epub 2006 Aug 31 PubMed.

Further Reading

No Available Further Reading