| |
REAGENTS/MATERIAL:
Brain tissue/CSF used in this project was provided by the Alzheimer's Disease Research Center, University of Southern California, and Institute for Brain Aging and Dementia, University of California, Irvine.
Five, and twenty four month old F344 x BN-F1 male rats were used in our experiments. The animals were fed ad libitum.
Original anti-neuronal nuclei monoclonal antibody solution (NeuN, Chemicon International Inc.) for detection of neurons was diluted 1:500;
anti-glial fibrillary acidic protein solution (GFAP, Boeringer Manheim) for detection of astrocytes was diluted 1:30;
human leukocyte antigen (HLA-DR, Dako) to detect human microglial cells was diluted 1:500;
ox-42 (Serotec Ltd.) to detect rat microglial cells was diluted 1:500.
A DSCR1 (Adapt78) fragment spanning exons 1, 5, 6, and 7 was synthesized by RT-PCR, the fragment was cloned into the Sma I site of the pBluscript II SK vector which is located between the recognition sites for T3 and T7 polymerases.
Probes were prepared using TransProbe T kit (Pharmacia, Biotech) following the manufacture's protocol.
Primers to amplify human DSCR1 (Adapt78) mRNA isoform consisting of exons 1, 5, 6, and 7 were
5’- GACTGGAGCTTCATTGACTGCGAGA - 3’, corresponding to bases 1-25 of exon1;
5’- ACCACGCTGGGAGTGGTGTCAGTCG -3’, corresponding to bases 1-25 of exon 7.
FUTURE DIRECTION:
Binding and regulation of calcineurin might be not the only function or major function of DSCR1 (Adapt78). Further tested needed for the possibility that DSCR1 (Adapt78) may function as an as RNA or DNA binding protein
|
Home
I recommend this paper
View all comments by Benjamin Wolozin
